Primer Sequences for GeneTrap Vectors (CMHD)
Primer Name and It's Use
Vector Name 3'RACE RT 3'RACE (1st) 3'RACE (2nd) 3'RACE Seq 5'RACE RT 5' RACE (1st) 5' RACE (2nd) 5'RACE Seq Extra or Comments
                   
pBgal GTlacZ1+SM2         5CD2 5'RACE1  5CD2, 5'RACE1 5'RACE for both + & -
            10x UPM Nest1     
pGT1 3CDs SD5-P1 SD5-P3 SD5-P3, 3'RACE1          
    10x UPM Nest1             
pGT6 / 7 / 8 3CDs SD5-P1 SD5-P3 SD5-P3          
    10x UPM Nest1             
pGTlox4 3CDs pGTlox4-1 pGTlox4-2 pGLox4-P4          
    10x UPM Nest1             
pMS1 3CDs SD5-P3  3'RACE1 3S1, SD5-P3, 3'RACE1 GTlacZ1[1] 5CD2 5'RACE1 5CD2, 5'RACE1  
    10x UPM Nest1      10x UPM Nest1     
pMS2 / 3 3CDs SD5-P3  3'RACE1 3S1          
    10x UPM Nest1             
pNH94 GTlacZ1[2]       GTlacZ1[3] 5CD2 5'RACE1 5CD2, 5'RACE1 only for LacZ+ 5RACE
            10x UPM Nest1     
pNH120 3CDs SD5-P3  3'RACE1 3S1, SD5-P3, 3'RACE1 GTlacZ1[4] 5CD2 5'RACE1 5CD2, 5'RACE1 same as pMS1
    10x UPM Nest1      10x UPM Nest1     
pNMDi3 / 4 3CDs SD5-P1 SD5-P3 SD5-P3          
    10x UPM Nest1             
pGepNMDi3 3CDs SD5-P1 SD5-P3 SD5-P3          
    10x UPM Nest1             
pPT1         5CDs or GTlacZ1 5CD2 5'RACE1 5CD2, 5'RACE1  
            10x UPM Nest1     
SD5 3CDs SD5-P1 SD5-P3 SD5-P3          
    10x UPM Nest1             
pGepSD5 3CDs SD5-P1 SD5-P3 SD5-P3          
    10x UPM Nest1             
pUPA 3CDs pUPAtrap6 pUPAtrap3 pUPAtrap7          
    10x UPM Nest1             
                   
                   
List of Primers used for Genetrap (CMHD)
Primer Name Primer Sequence 5'--> 3')  
3CDs    AAG CAG TGG TAA CAA CGC AGA GTA CTT TTT TTT TTT TTT TTT TTT TTT TTT TTT TVN  
GTlacZ2   GAC TCT GGC GCC GCT GCT CTG TCA G  
SM2    AAG CAG TGG TAA CAA CGC AGA GTA CGC GGG  
5CDs   TTT TTT TTT TTT TTT TTT TTT TTT TVN  
10x UPM   0.4 μM UPL + 2 μM UPS (2.5μl in 25μl reaction)  
UPL   CTA ATA CGA CTC ACT ATA GGG CAA GCA GTG GTA ACA ACG CAG AGT  
UPS   CTA ATA CGA CTC ACT ATA GGG C  
Nest1    AAG CAG TGG TAA CAA CGC AGA GT  
SD5-P1   GCT TGC CGA ATA TCA TGG TGG AAA ATG G  
SD5-P3 (3'RACE7, 3pMS1-1) CGC ATC GCC TTC TAT CGC CTT CTT GAC G  
3'RACE1  (3pMS1-2) CAA GCG ACG CCC AAC CTG CCA TCA CGA G  
3S1 (sequence1) CGG GGA TCT CAT GCT GGA  
pUPAtrap6   TAT AGC ATA CAT TAT ACG AAG TTA TCC GCT CGA C  
pUPAtrap3   GCC ATG CAC CAT GGT TCG AAA TTC CAG  
pUPAtrap7   ATT CCA GAC AAG TTT GTT GTT GGA TAT GCC  
5CD2 (5PT-1, 5PT-P1) GAC TCT GGC GCC GCT GCT CTG TCA GGT  
5'RACE1 (5PT-2, 5PT-P2 ) ACC TGT TGG TCT GAA ACT CAG CCT TGA G  
pGLox4-P1 (pGLox1) CCG CAT CTT CAC TGG TGT CAA TGT ATA  
pGLox4-P2 (pGLox2) TAT ATC ATT TTA CTG GGG GAC CTT GTG C  
pGLox4-P4 (pGLox4) AAG CCA TAG TGA AGG ACA GTG ATG GA  
Nested2   CCT GTT GGT CTG AAA CTC AGC CT  
       
bsdL   GTTATGTGTGGGAGGGCTAAGCAAT  
NeoL    GCTATCAGGACATAGCGTTGGCTAC  
       
       

[1]
Administrator:
5CDs for Powerscript RT, GTlacZ1 for CloneTech. later with some SM2
[2]
Administrator:
5CDs for Powerscript RT, GTlacZ1 for CloneTech. later with some SM2
[3]
Administrator:
5CDs for Powerscript RT, GTlacZ1 for CloneTech. later with some SM2
[4]
Administrator:
5CDs for Powerscript RT, GTlacZ1 for CloneTech. later with some SM2